ID: 962892057_962892065

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 962892057 962892065
Species Human (GRCh38) Human (GRCh38)
Location 3:139680525-139680547 3:139680565-139680587
Sequence CCCTAGAAAACTGTGTGAAGAGC CACCCAAGGCTGCAGGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 170} {0: 1, 1: 0, 2: 5, 3: 21, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!