ID: 962895446_962895457

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 962895446 962895457
Species Human (GRCh38) Human (GRCh38)
Location 3:139709849-139709871 3:139709896-139709918
Sequence CCACTGAGTCCCTTTCCTGGGAT CCGCAACTCTCATGGCTTCACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 38, 4: 299} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!