ID: 962895451_962895461

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 962895451 962895461
Species Human (GRCh38) Human (GRCh38)
Location 3:139709877-139709899 3:139709917-139709939
Sequence CCCCAGAGATTCAGGAGTCCCGC GGAGGTGATGTCATGGATTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 24, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!