ID: 962898945_962898949

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 962898945 962898949
Species Human (GRCh38) Human (GRCh38)
Location 3:139740344-139740366 3:139740362-139740384
Sequence CCACACAAAAGTCCAGGCTCCTG TCCTGCCCTGATGGGACCTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 29, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!