ID: 962921342_962921351

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 962921342 962921351
Species Human (GRCh38) Human (GRCh38)
Location 3:139953246-139953268 3:139953278-139953300
Sequence CCTCTATGCCCACACAGATCCTC GGATTGAGAAACTACCTATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 221} {0: 3, 1: 89, 2: 582, 3: 1423, 4: 2386}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!