ID: 962921342_962921354

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 962921342 962921354
Species Human (GRCh38) Human (GRCh38)
Location 3:139953246-139953268 3:139953298-139953320
Sequence CCTCTATGCCCACACAGATCCTC GGGTACTCTGTTTATTACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 221} {0: 1, 1: 19, 2: 256, 3: 953, 4: 3410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!