ID: 962922412_962922421

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 962922412 962922421
Species Human (GRCh38) Human (GRCh38)
Location 3:139963074-139963096 3:139963088-139963110
Sequence CCCTCATAAAAGATGAGAATGAG GAGAATGAGGAGGAGGAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 310} {0: 1, 1: 14, 2: 195, 3: 1191, 4: 4908}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!