ID: 962927092_962927094

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 962927092 962927094
Species Human (GRCh38) Human (GRCh38)
Location 3:140004954-140004976 3:140004974-140004996
Sequence CCACAGTTTATGATTCAAAAACA ACAAGTGCTGTTGCATTAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 345} {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!