ID: 962990473_962990476

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 962990473 962990476
Species Human (GRCh38) Human (GRCh38)
Location 3:140573064-140573086 3:140573082-140573104
Sequence CCACCTGCCAGGTTTCTGTAAGC TAAGCTGAGCAGCCTCTTCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 165} {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!