ID: 963015499_963015508

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 963015499 963015508
Species Human (GRCh38) Human (GRCh38)
Location 3:140820543-140820565 3:140820559-140820581
Sequence CCTGTGACTATCAGCCATTGACT ATTGACTGGGTGGTGGGTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 43, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!