ID: 963040200_963040206

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 963040200 963040206
Species Human (GRCh38) Human (GRCh38)
Location 3:141064803-141064825 3:141064830-141064852
Sequence CCAAGTAGTCCGAGCTCCTTGGG GTCTGGTTTCCTAGTGATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 50, 3: 898, 4: 3213} {0: 1, 1: 0, 2: 1, 3: 8, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!