ID: 963063860_963063869

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 963063860 963063869
Species Human (GRCh38) Human (GRCh38)
Location 3:141246948-141246970 3:141247001-141247023
Sequence CCTGTCTCAGCTCACCAGAGTCC GCTGGCTCCAGCATGCTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 903} {0: 1, 1: 1, 2: 3, 3: 27, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!