ID: 963068679_963068690

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 963068679 963068690
Species Human (GRCh38) Human (GRCh38)
Location 3:141284213-141284235 3:141284260-141284282
Sequence CCTGGTCATTCAGGGCCCCAGGT ATCCCCTGGGGATGGCTACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 221} {0: 1, 1: 0, 2: 0, 3: 18, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!