ID: 963097330_963097338

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 963097330 963097338
Species Human (GRCh38) Human (GRCh38)
Location 3:141557849-141557871 3:141557885-141557907
Sequence CCCCCAAGGTTCCAAATCTGGAA GGGAAGAAGGAAAATAAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 162} {0: 1, 1: 0, 2: 17, 3: 194, 4: 1641}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!