ID: 963103073_963103084

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 963103073 963103084
Species Human (GRCh38) Human (GRCh38)
Location 3:141623839-141623861 3:141623874-141623896
Sequence CCCGCCCAGCCTCAGTAAGGACT GCCTCTCTCAGGTGACTCACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 230} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!