ID: 963114383_963114389

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 963114383 963114389
Species Human (GRCh38) Human (GRCh38)
Location 3:141713926-141713948 3:141713959-141713981
Sequence CCACATCCCCAGTGGGCCAAGTA CTACTGTAGAAAAAGCTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113} {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!