|
Left Crispr |
Right Crispr |
| Crispr ID |
963154011 |
963154023 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:142076993-142077015
|
3:142077043-142077065
|
| Sequence |
CCCCTGGCAGCAGCCATGTGGCA |
AGGGAGAGCTCAGTGACTGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 9, 2: 26, 3: 95, 4: 410} |
{0: 1, 1: 16, 2: 74, 3: 156, 4: 459} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|