|
Left Crispr |
Right Crispr |
| Crispr ID |
963154352 |
963154358 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:142079638-142079660
|
3:142079684-142079706
|
| Sequence |
CCCCAAGAGAAAAGAAACAAATA |
CCCGGCAGCAGACTTTTCAGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 9, 2: 19, 3: 193, 4: 1983} |
{0: 2, 1: 24, 2: 323, 3: 557, 4: 678} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|