ID: 963168045_963168051

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 963168045 963168051
Species Human (GRCh38) Human (GRCh38)
Location 3:142225181-142225203 3:142225200-142225222
Sequence CCCGCGGGTGCTGCAGGTGGCCG GCCGCGTCCAGGGCGGTAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 260} {0: 1, 1: 0, 2: 0, 3: 13, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!