ID: 963182961_963182963

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 963182961 963182963
Species Human (GRCh38) Human (GRCh38)
Location 3:142379707-142379729 3:142379728-142379750
Sequence CCTTTGCAGAAAGGCCATTTGTC TCACTTGCAACTAAAAATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 141} {0: 1, 1: 1, 2: 3, 3: 19, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!