ID: 963188874_963188881

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 963188874 963188881
Species Human (GRCh38) Human (GRCh38)
Location 3:142447470-142447492 3:142447518-142447540
Sequence CCGCTCTGGGTGGGATGGGGGAA CGCAGCCTCTGTAAGGAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 314} {0: 1, 1: 0, 2: 1, 3: 6, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!