|
Left Crispr |
Right Crispr |
| Crispr ID |
963210160 |
963210164 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:142680322-142680344
|
3:142680350-142680372
|
| Sequence |
CCCAAAGTGCTGGAATTATAGGC |
CCACCATGCCTGGCCAAAACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1032, 1: 30665, 2: 261001, 3: 272072, 4: 169172} |
{0: 6, 1: 28, 2: 174, 3: 703, 4: 2141} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|