|
Left Crispr |
Right Crispr |
| Crispr ID |
963217655 |
963217656 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:142767770-142767792
|
3:142767791-142767813
|
| Sequence |
CCTGTTCTGGATATTTCATATGA |
GAATGACATCTTTTGCTTAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 52, 2: 415, 3: 1509, 4: 2689} |
{0: 1, 1: 1, 2: 1, 3: 11, 4: 211} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|