ID: 963235864_963235870

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 963235864 963235870
Species Human (GRCh38) Human (GRCh38)
Location 3:142955251-142955273 3:142955292-142955314
Sequence CCTTTGTTTGGAAATGGGTGAAC GGAGAAGGCCTAAATACACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 519} {0: 1, 1: 0, 2: 0, 3: 11, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!