|
Left Crispr |
Right Crispr |
| Crispr ID |
963271166 |
963271171 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:143287080-143287102
|
3:143287104-143287126
|
| Sequence |
CCTCCTTCCTTCTGGTCCCACTT |
TGTGTGTGTGTGTGTGTGTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 7, 3: 59, 4: 555} |
{0: 3779, 1: 5173, 2: 8013, 3: 13571, 4: 22268} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|