ID: 963275975_963275980

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 963275975 963275980
Species Human (GRCh38) Human (GRCh38)
Location 3:143330062-143330084 3:143330078-143330100
Sequence CCATGCCTGGCTTAGACTCCTGG CTCCTGGTGGAGGAGACAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 716} {0: 1, 1: 1, 2: 4, 3: 51, 4: 468}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!