|
Left Crispr |
Right Crispr |
| Crispr ID |
963284626 |
963284630 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:143421804-143421826
|
3:143421850-143421872
|
| Sequence |
CCCACAGAATAGGAGAAAATATT |
GTCTAATACCAGAATCTACAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 232, 1: 3157, 2: 14774, 3: 17972, 4: 9612} |
{0: 1, 1: 4, 2: 16, 3: 38, 4: 180} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|