ID: 963284627_963284630

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 963284627 963284630
Species Human (GRCh38) Human (GRCh38)
Location 3:143421805-143421827 3:143421850-143421872
Sequence CCACAGAATAGGAGAAAATATTT GTCTAATACCAGAATCTACAGGG
Strand - +
Off-target summary {0: 103, 1: 1398, 2: 2838, 3: 3778, 4: 4927} {0: 1, 1: 4, 2: 16, 3: 38, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!