ID: 963286118_963286124

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 963286118 963286124
Species Human (GRCh38) Human (GRCh38)
Location 3:143436131-143436153 3:143436149-143436171
Sequence CCTGTCCGGACATCAGGGCTGGG CTGGGGGTGTCCACTGGTACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133} {0: 1, 1: 0, 2: 1, 3: 17, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!