ID: 963286122_963286124

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 963286122 963286124
Species Human (GRCh38) Human (GRCh38)
Location 3:143436136-143436158 3:143436149-143436171
Sequence CCGGACATCAGGGCTGGGGGTGT CTGGGGGTGTCCACTGGTACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 218} {0: 1, 1: 0, 2: 1, 3: 17, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!