ID: 963295488_963295496

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 963295488 963295496
Species Human (GRCh38) Human (GRCh38)
Location 3:143541626-143541648 3:143541651-143541673
Sequence CCTTGAGCAATGACCCATGTCCA TTGACCCTGGGTTGGAAAACTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 12, 4: 115} {0: 1, 1: 0, 2: 0, 3: 17, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!