ID: 963309968_963309971

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 963309968 963309971
Species Human (GRCh38) Human (GRCh38)
Location 3:143699469-143699491 3:143699494-143699516
Sequence CCTGGCAGCAGCAGTGTAGCATG TAAAGAGAATCTGTGCTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 31, 4: 268} {0: 1, 1: 0, 2: 4, 3: 34, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!