ID: 963323886_963323894

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 963323886 963323894
Species Human (GRCh38) Human (GRCh38)
Location 3:143839948-143839970 3:143839984-143840006
Sequence CCTCCCCCTTTCACCATAGGAGA AAAGAAATAAGAGAAAACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 155} {0: 1, 1: 2, 2: 24, 3: 354, 4: 3307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!