ID: 963341424_963341433

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 963341424 963341433
Species Human (GRCh38) Human (GRCh38)
Location 3:144039331-144039353 3:144039360-144039382
Sequence CCTGGAAGACCTGTAACAGCCAT AGGACTCGTTGGGGGAACAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 149} {0: 1, 1: 0, 2: 0, 3: 10, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!