ID: 963361765_963361769

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 963361765 963361769
Species Human (GRCh38) Human (GRCh38)
Location 3:144282650-144282672 3:144282682-144282704
Sequence CCTTTAAGGGAGGGGCAGAAAAA CCTATAAATAGCCTATCACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 271} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!