ID: 963384966_963384972

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 963384966 963384972
Species Human (GRCh38) Human (GRCh38)
Location 3:144581155-144581177 3:144581195-144581217
Sequence CCGAGAAACATGATGTAATGGTG GTGCCAGAGGAGGAGCCGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!