ID: 963525423_963525429

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 963525423 963525429
Species Human (GRCh38) Human (GRCh38)
Location 3:146409471-146409493 3:146409508-146409530
Sequence CCATGGAGGGGGCCTTCTGACCA TTAATGTAGGGAAACTGATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 246} {0: 1, 1: 21, 2: 15, 3: 22, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!