ID: 963572888_963572899

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 963572888 963572899
Species Human (GRCh38) Human (GRCh38)
Location 3:147019970-147019992 3:147020018-147020040
Sequence CCCCCCAAACTCAAAAAAGAAGG GATTTGACTGGTGCTTTGAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 26, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!