ID: 963605287_963605291

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 963605287 963605291
Species Human (GRCh38) Human (GRCh38)
Location 3:147407759-147407781 3:147407801-147407823
Sequence CCCGCATCCGCGTGCATTTTTTG GGCTTAATTGATTGAGTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47} {0: 1, 1: 0, 2: 2, 3: 16, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!