ID: 963605595_963605601

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 963605595 963605601
Species Human (GRCh38) Human (GRCh38)
Location 3:147409918-147409940 3:147409939-147409961
Sequence CCGGCCAGCGCCCGGGCGCGCCG CGCGCCATTGCCTGCAGGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 258} {0: 1, 1: 0, 2: 2, 3: 30, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!