ID: 963605596_963605604

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 963605596 963605604
Species Human (GRCh38) Human (GRCh38)
Location 3:147409922-147409944 3:147409950-147409972
Sequence CCAGCGCCCGGGCGCGCCGCGCC CTGCAGGCTAGGACTTCGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 108, 4: 655} {0: 1, 1: 0, 2: 0, 3: 4, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!