ID: 963605596_963605606

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 963605596 963605606
Species Human (GRCh38) Human (GRCh38)
Location 3:147409922-147409944 3:147409954-147409976
Sequence CCAGCGCCCGGGCGCGCCGCGCC AGGCTAGGACTTCGCGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 108, 4: 655} {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!