ID: 963609743_963609752

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 963609743 963609752
Species Human (GRCh38) Human (GRCh38)
Location 3:147452362-147452384 3:147452412-147452434
Sequence CCGGGACATGGTGATTGAGTTGG CTGGAGACACAGGTGGTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 113} {0: 1, 1: 0, 2: 0, 3: 27, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!