ID: 963612816_963612819

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 963612816 963612819
Species Human (GRCh38) Human (GRCh38)
Location 3:147493598-147493620 3:147493642-147493664
Sequence CCCTTTTCTCTGAATAATATTAG GATTTCCTCTAAAATATCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 512} {0: 2, 1: 0, 2: 3, 3: 12, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!