ID: 963630306_963630313

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 963630306 963630313
Species Human (GRCh38) Human (GRCh38)
Location 3:147723189-147723211 3:147723238-147723260
Sequence CCCTGTAATCTTCTGCAGATAAC GGTCTGTTACTGGGCTTTGGTGG
Strand - +
Off-target summary No data {0: 17, 1: 155, 2: 153, 3: 106, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!