ID: 963664144_963664148

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 963664144 963664148
Species Human (GRCh38) Human (GRCh38)
Location 3:148160932-148160954 3:148160961-148160983
Sequence CCTTCAGCAACCAACAACCTAAT GCAGACATCAACATCAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 40, 3: 381, 4: 770} {0: 1, 1: 10, 2: 12, 3: 40, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!