ID: 963686005_963686007

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 963686005 963686007
Species Human (GRCh38) Human (GRCh38)
Location 3:148434767-148434789 3:148434789-148434811
Sequence CCTCCTTCTTGAAGCTGTCTATT TTGCATCAAAGTAGATAAATTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 356} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!