|
Left Crispr |
Right Crispr |
| Crispr ID |
963716852 |
963716861 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:148812646-148812668
|
3:148812697-148812719
|
| Sequence |
CCATGATTATGAGGCCTCCCCAG |
CTCTTTCTGTTCCCAGTTTCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 274, 1: 5530, 2: 6803, 3: 4191, 4: 2220} |
{0: 5, 1: 83, 2: 160, 3: 868, 4: 1409} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|