|
Left Crispr |
Right Crispr |
Crispr ID |
963721896 |
963721905 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:148871018-148871040
|
3:148871067-148871089
|
Sequence |
CCTCCCGAGTAGCTTATACTACA |
TTTTGTATTTTTAGTAAAGACGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 23, 2: 2766, 3: 73360, 4: 215646} |
{0: 4804, 1: 204017, 2: 138856, 3: 62551, 4: 38642} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|