|
Left Crispr |
Right Crispr |
| Crispr ID |
963721896 |
963721906 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:148871018-148871040
|
3:148871068-148871090
|
| Sequence |
CCTCCCGAGTAGCTTATACTACA |
TTTGTATTTTTAGTAAAGACGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 23, 2: 2766, 3: 73360, 4: 215646} |
{0: 4282, 1: 174594, 2: 210485, 3: 120972, 4: 65351} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|